Bradyrhizobia Nodulating the Acacia mangium x A. auriculiformis Interspecific Hybrid Are Specific and Differ from Those Associated with Both Parental Species

of 8

Please download to get full document.

View again

All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
PDF
8 pages
0 downs
2 views
Share
Description
Bradyrhizobia Nodulating the Acacia mangium x A. auriculiformis Interspecific Hybrid Are Specific and Differ from Those Associated with Both Parental Species
Tags
Transcript
   A  PPLIED AND  E NVIRONMENTAL   M ICROBIOLOGY , Dec. 2009, p. 7752–7759 Vol. 75, No. 240099-2240/09/$12.00 doi:10.1128/AEM.01887-09Copyright © 2009, American Society for Microbiology. All Rights Reserved. Bradyrhizobia Nodulating the  Acacia mangium   A. auriculiformis Interspecific Hybrid Are Specific and Differ from Those Associated with Both Parental Species  † Christine Le Roux, 1 ‡ Diana Tentchev, 1 ‡§ Yves Prin, 1 Doreen Goh, 4 Yani Japarudin, 5 Marie-Mathilde Perrineau, 1 Robin Duponnois, 2 Odile Domergue, 3 Philippe de Lajudie, 2 and Antoine Galiana 1 * CIRAD, UMR LSTM, F-34398 Montpellier Cedex 5, France 1  ; IRD, UMR LSTM, F-34398 Montpellier Cedex 5, France 2  ; INRA,UMR LSTM, F-34398 Montpellier Cedex 5, France 3  ; YSG Biotech Sdn. Bhd., Plant Biotechnology Laboratory, P.O. Box 11623,88817 Kota Kinabalu, Sabah, Malaysia 4  ; and Sabah Softwoods Sdn. Bhd., P.O. Box 60966, 91019 Tawau, Sabah, Malaysia 5 Received 6 August 2009/Accepted 14 October 2009 In the context of an increasing utilization of the interspecific hybrid  Acacia mangium   A. auriculiformis  asa plantation tree in the tropical humid zone, its symbiotic characterization was carried out in comparison withthat of its two parental species. Rhizobium strains of diverse geographical srcins were isolated from rootnodules of the hybrid and its parents. Almost all  Acacia  hybrid isolates were fast growing on yeast extract-mannitol medium, in contrast to those isolated from both parental species, which were mostly slow growing.The rhizobium strains were characterized through partial sequencing of the rRNA operon. In the phylogenetictree, almost all strains isolated from the hybrid were grouped together in a clade close to  Bradyrhizobium  japonicum , while all strains isolated from both parental species were close to  Bradyrhizobium elkanii . Inocula-tion experiments performed under in vitro or greenhouse conditions showed that all strains were infective withtheir srcinal hosts but exhibited very variable degrees of effectivity according to the host plant tested. Thus,homologous strain-host associations were more effective than heterologous ones. This shows that there is stilla high potential for isolating and testing new strains from hybrids to be used as inoculants in the context of large-scale afforestation programs. Due to the abundance and diversity of tropical legume trees,many studies have investigated the nitrogen-fixing status of these trees from natural forests (7, 30, 37) and agroforestrysystems (2). Concerning acacias, most of the studies were fo-cused on the characterization of rhizobia associated with Af-rican dry-zone species (10, 11, 12, 23, 29, 41, 60), while only afew reports exist on rhizobia associated with Australasian  Aca- cia  spp. belonging to the  Phyllodineae  tribe (24, 28, 40, 57). Inthe last two decades, the acacias native to Australia and PapuaNew Guinea,  A. mangium  and  A. auriculiformis  in particular,have been extensively planted in the humid tropics, mostly inSoutheast Asia for pulp production, reaching a total estimatedarea of about 2 million hectares (54). The first occurrence of spontaneous hybrids between  A. mangium  and  A. auriculifor- mis  was observed in 1972 in Malaysia (38), and hybrids wereobtained later from controlled pollination (43, 47). More re-cently, the  A. mangium    A. auriculiformis  hybrid was identi-fied as a very promising tree to be used in clonal plantations,since it was shown to have higher wood productivity than bothparental species, as well as higher wood density and cellulosecontent and better tolerance for diseases, heart rot in partic-ular, than  A. mangium  (38, 42).The symbiotic properties of both parental species,  A. man- gium  and  A. auriculiformis , and the characteristics of the asso-ciated rhizobium strains have been reported in a few studies (5,15, 33, 35, 53). Both  Acacia  species are generally considered tobe poorly specific, as they form efficient nodules with anyslow-growing  Bradyrhizobium  strain tested. However, it wasshown that  A. mangium  was a specific species in terms of effectivity, since the effect of inoculation varied greatly accord-ing to the  Bradyrhizobium  strain inoculated, in contrast with  A. auriculiformis , in which all the  Bradyrhizobium  strains testedhad the same effectivity (15). Before the present study, no workhas been done on the symbiotic characterization of the  A. mangium   A. auriculiformis  hybrid and its associated strains.Earlier inoculation trials performed on the hybrid in a nurseryin Sabah (Malaysia) showed that a strain isolated from anhybrid, namely, AH12c, had a positive effect on plant growth, whereas inoculation with Aust13c, isolated from  A. mangium and previously known to be one of the most high-performingand competitive strains with  A. mangium  (17, 19), had no effecton the growth of the hybrid (20). These prior observations thussuggested that the hybrid was symbiotically more specific thanboth parental species. Even though a very few studies of sym-biotic specificity between rhizobia from interspecific hybrids versus parental species have been reported in the literature(27, 44, 45, 46), no phylogenetic study has been performed onsuch symbiotic models so far.The objective of the present study was to evaluate the sym- * Corresponding author. Mailing address: LSTM, Campus Interna-tional de Baillarguet, TA A-82/J, 34398 Montpellier Cedex 5, France.Phone: (33) 4 67 59 38 51. Fax: (33) 4 67 59 38 02. E-mail: galiana@cirad.fr.§ Present address: INRA, Unite´ de Pathologie Ve´ge´tale, Domaine Saint Maurice, BP 94, 84143 Montfavet Cedex, France.‡ Christine Le Roux and Diana Tentchev contributed equally to thispaper.† Supplemental material for this article may be found at http://aem.asm.org/.  Published ahead of print on 23 October 2009.7752  biotic properties and specificity of the  A. mangium    A. au- riculiformis  hybrid in comparison with those of both parentalspecies at two different levels: (i) analysis of the moleculardiversity of isolates from  A. mangium ,  A. auriculiformis , andthe hybrid in relation to their plant species and geographicalsrcins and (ii) evaluation of symbiotic specificity between therhizobial strains isolated and the three  Acacia  hosts throughcross-inoculation experiments under controlled conditions. MATERIALS AND METHODSOrigin and isolation of bacterial strains.  The rhizobium strains used in thepresent study were isolated from root nodules of   A. mangium ,  A. auriculiformis ,and  A. mangium    A. auriculiformis  hybrids collected in different introductionzones, mostly in Malaysia, except for Aust13c that srcinates from Australia, thenatural distribution area of   A. mangium  (Table 1). The root nodules from  A. mangium  and  A. auriculiformis  were collected from pure srcins, while hybrids were genetically and/or phenotypically identified before nodule collection. Nod-ule isolates from genetically identified  Acacia  hybrids were labeled using the“AH” prefix, while those from phenotypically identified trees were labeled using“Ah” (Table 1). All “Ah” isolates srcinated from adult trees from genetic trialsin Brumas (Sabah Softwoods Sdn. Bhd. Forest Company) which were identifiedaccording to easily distinguishable phenotypic traits, including leaf and podshapes and flower color, all intermediary with those of parents. On the otherhand, “AH” isolates were collected from 1.5-year-old trees planted in Luasong(Yayasan Sabah Group Sdn. Bhd.) that srcinated from phenotypically andgenotypically identified hybrid clones produced as described below. Fresh rootnodules were collected in different planting areas before direct isolation of bacteria the following day. The nodules were first rinsed in Eppendorf tubescontaining tap water supplemented with a drop of Tween 20 and then immersedin 70% ethanol for 30 s before being surface sterilized in a solution of 0.1%HgCl 2  for 1 to 2 min according to the nodule size. After being washed in steriledistilled water, each nodule collected was crushed in a drop of sterile distilled water and then plated by bacterial streaking onto yeast extract-mannitol (YEM)agar plates (55). The agar plates were incubated in a dark room at 28°C for 5 daysbefore a second transfer of the bacterial isolates onto fresh YEM agar medium.Before use, the bacterial isolates were stored in 25% glycerol at  80°C. Phenotypic characterization of bacterial strains.  The bacterial strains wereconsidered to be either fast growing or slow growing based on the criteria of Jordan (22). Fast-growing isolates developed colonies   1 mm in diameter onYEM agar plates in 3 days at 27°C, while slow-growing ones developed visiblecolonies after 5 days. Colony morphology and mucus production were evaluatedat the same time. 16S-23S rRNA gene ITS sequencing and phylogenetic analysis.  After 7 days of incubation at 28°C on YEM agar plates, rhizobial single colonies were suspendedin 200   l of sterile distilled water in Eppendorf tubes. The bacterial cells werelysed by several cycles of heat shocks programmed in a Perkin-Elmer model 2400thermocycler. The tubes were held at 4°C overnight before the collection of 2  lof supernatant for PCR. Twenty-five  l of reaction mixture containing 200  Mof each deoxynucleoside triphosphate, 0.8   M of each primer (Eurogentec, Angers, France), 1.5 mM of MgCl 2 , 1.25 U of   Taq  DNA polymerase (Promega,France), and the buffer supplied with the enzyme was used for PCR amplificationby a Perkin-Elmer model 2400 thermocycler. The internal transcribed spacer(ITS) of the 16S and 23S rRNA genes was amplified using primers 16S-870f CCTGGGGAGTACGGTCGCAAG (48) and FGPL132  CCGGGTTTCCCCA TTCGG (39). The PCR cycles were performed as described by Leblanc et al.(25). Then, the PCR products were run on a 1% agarose gel (Sigma, France) inTris-acetate-EDTA buffer with a DNA size standard (Eurogentec Smartladder).The amplified fragment of about 1,600 bp obtained (9) was purified with aQIAquick gel extraction kit (Qiagen, France). The purified PCR products weresequenced using primers BR5 CTTGTAGCTCAGTTGGTTAG (58) andFGPL132  . Sequencing reactions were analyzed on an Applied Biosystemsmodel 310 DNA automated sequencer using a BigDye Terminator cycle se- TABLE 1. Bacterial strains isolated from  Acacia auriculiformis ,  Acacia mangium , and  A. mangium   A. auriculiformis  hybrid Strainname  a  Original host plant Accession no. Geographical origin Latitude,longitude Growth  b  Aa1a  Acacia auriculiformis  FJ025844 Brumas (Sabah), Malaysia 4°4  N, 117°8  E S Aa1d FJ025845 S Aa2c FJ025846 S Aa20103 FJ025850 Combi, French Guiana 5°3  N, 52°9  W SCGA1 None SScia2 FJ025847 Sangoue, Coˆte d’Ivoire 7°5  N, 7°5  W STAL1449 FJ025848 Hawaii 20°9  N, 156°4  E S Am1d  Acacia mangium  FJ025833 Brumas (Sabah), Malaysia 4°4  N, 117°8  E S Am2c FJ025830 F Am3b FJ025832 S Am3d FJ025831 S AG31d FJ025849 Anguededou, Coˆte d’Ivoire 5°4  N, 4°0  W S Aust13c AY603956  c Daintree, Queensland, Australia16°1  S, 145°2  E S Am20101 FJ025853 Combi, French Guiana 5°3  N, 52°9  W S Am20102b FJ025852 S Am20102d FJ025851 S Ah1a  A. mangium   A. auriculiformis hybridFJ025835 Brumas (Sabah), Malaysia 4°4  N, 117°8  E S Ah4a FJ025838 S Ah5d FJ025834 F Ah6b FJ025837 F AH8c FJ025836 Luasong (Sabah), Malaysia 4°6  N, 117°4  E S AH8i FJ025840 F AH8j FJ025843 F AH10 FJ025839 F AH11a GQ443307 F AH11e FJ025841 F AH12c FJ025842 F  a Strains are grouped by host plant and then geographical srcin and latitude/longitude. For strains from a given host species, those having the same number in theirname were isolated from the same tree but from different nodules, as differentiated by the last letter in the name.  b F, fast-growing isolates developing colonies  1 mm in diameter on YEM agar plates in 3 days at 27°C; S, slow-growing isolates developing visible colonies after5 days in the same conditions.  c  Accession number was previously published by Andre et al. (1). V OL  . 75, 2009 SPECIFICITY OF BRADYRHIZOBIA FROM  ACACIA  HYBRID 7753  quencing kit (Perkin-Elmer Applied Biosystems). Multiple alignments were per-formed with Clustal_X (52), and phylogenetic analyses were performed withmaximum parsimony using MEGA (Molecular Evolutionary Genetic Analysis version 4.0.1) (51). Confidence in the phylogenetic groupings was assessed by thebootstrap method, with 1,000 replications. Sequences of related organisms fromthe alphaproteobacteria were included in the analysis, in particular, one strain of each genospecies characterized by Willems et al. (58, 59). Symbiotic specificity between rhizobial strains and host plants.  We used thesame srcins of plant materials for both in vitro and greenhouse experiments: the  A. mangium  seeds, furnished by the forestry company Innoprise CorporationSdn. Bhd., srcinated from a seed orchard located in Luasong (State of Sabah,Malaysia) which was initially set up using seeds of Papua New Guinean prove-nance. The  Acacia auriculiformis  seeds srcinated from Australia (CSIRO TreeSeed Center, seed lot no. 16142, Coen River provenance, Queensland). Bothseed lots were pretreated with 95% H 2 SO 4  during 1 h for  A. mangium  and 30 minfor  A. auriculiformis  and then surface-sterilized for 5 min in a 5% (wt/vol)calcium hypochlorite solution before being rinsed in sterile distilled water. Thesterilized seeds were transferred for germination into dishes containing steriledistilled water supplemented with 0.3% Phytagel (Sigma-Aldrich, France) beforeincubation in lighted culture rooms at 28°C under a 16-h photoperiod.The  A. mangium    A. auriculiformis  hybrid plants tested were the followingclones: no. 1-24, 3-26, 4-21, 6-27, 7-23, 10-23, 10-24, and 11-28. These eight clones were produced from seeds of a 5-year-old  A. mangium  mother tree planted inOume´ (Coˆte d’Ivoire) and selected based on phenotypic and genotypic identifi-cation criteria as described by Galiana et al. (20). The  Acacia  hybrid clones werepropagated through microcutting and maintained in in vitro conditions beforerhizobial inoculation experiments. Every 2 to 3 months, the microcuttings weresubcultured into 13- by 10-cm glass flasks filled up with a basal Murashige andSkoog culture medium (32) with macroelements at half strength and supple-mented with 0.1 mM NaFe-EDTA, vitamins (34), 1.07  M of NAA (  -naphtha-lene acetic acid), and 58.4 mM of sucrose. The pH was adjusted to 5.7, and themedium solidified with 0.3% Phytagel. The microcuttings consisted of shootsegments 2 to 3 cm in height composed of two nodes. The culture flasks wereplaced in culture rooms at 28°C under a 16-h photoperiod and light intensity of 60 microeinsteins (  E)    m  2   s  1 . Root initiation occurred at the shoot basisafter 1 week of culture, and the mean rooting rate reached 100% after 2 weeksof culture regardless of the  Acacia  clone used.In the in vitro experiment, the culture device consisted of a 220- by 25-mm testtube containing a polypropylene support, as described by Galiana et al. (15).Each test tube contained 25 ml of a sterile N-free Broughton and Dilworthnutrient solution (4). Seven days after H 2 SO 4  pretreatment, the germinatedseeds of   A. mangium  and  A .  auriculiformis  were transferred into the tubes, and10 days later, they were inoculated with 1 ml of a washed rhizobium culture at aconcentration of 10 9 bacteria per ml. The  A. mangium   A .  auriculiformis  hybridplants tested consisted of terminal microcuttings from the eight  Acacia  hybridclones described above. Fourteen days after their transfer onto rooting medium,i.e., 7 days after root initiation, the rooted microcuttings were transferred fromthe flasks to the tubes and, 5 days after the transfer, inoculated with 1 ml of a washed rhizobium culture containing 10 9 bacteria. All plant cultures were placedin culture rooms at 28°C under a 16-h photoperiod and light intensity of 60  E    m  2   s  1 . The infectivity and effectivity of each of the nine followingrhizobium strains were tested on  A. mangium ,  A. auriculiformis , and their hybrid: Aust13c, AG31d, and Am1d srcinating from  A. mangium ; TAL1449, Scia2, andCGA1 from  A. auriculiformis ; and AH12c, AH10, and Ah1a from the hybrid (see“Geographical srcin” in Table 1). Two additional hybrid-associated strains,namely, Ah4a and AH11a, were also tested on their homologous host. Eightreplicates per treatment, i.e., per  Acacia  host and per strain tested, were used.Concerning the hybrid, each of the 11 strains tested was inoculated to eightplants comprising the eight different clones described above (i.e., one plant perclone), so that each strain tested was inoculated to the same clonal composition.For each of the three  Acacia  hosts tested, the strain treatments were comparedto noninoculated control plants that consisted of eight replicates per  Acacia  hosttreated with 1 ml of an autoclaved rhizobium culture of the Aust13c strain.In the greenhouse experiment, the plants were transferred to 12- by 8-cmpolyethylene pots (modified Leonard jars) containing a 1/1 (vol/vol) perlite/  vermiculite mixture and fed weekly with a N-free nutrient solution (4). Thegerminated seeds of   A. mangium  and  A. auriculiformis  were individually trans-ferred into the pots 7 and 15 days, respectively, after seed scarification. Rootedmicrocuttings of the  Acacia  hybrid clone no. 3-21 were individually transferredinto the culture jars 2 weeks after their transfer onto in vitro rooting medium, i.e.,7 days after root initiation. The day following their transfer into the pots, plants were inoculated with 1 ml of rhizobium culture at a concentration of 10 9 bacteriaper ml. Both strain Aust13c from  A. mangium  and AH12c from the hybrid weretested on  A. mangium ,  A. auriculiformis , and the hybrid with, respectively, 11, 10,and 8 replicates per inoculation treatment. Uninoculated control plants weretreated with a 1-ml autoclaved rhizobium culture of the Aust13c strain. After 4 and 4.5 months of growth for in vitro and greenhouse experiments,respectively, all plants were collected to determine the shoot height and numberof nodules. The aerial parts and nodules were dried in an oven for 72 h at 60°Cbefore weight measurements. For each of the three  Acacia  species studied andeach parameter analyzed, all the data collected were subjected to a one-wayanalysis of variance. When the rhizobium strain factor had a significant effect ona given parameter, the means of the different treatments were ranked intohomogeneous groups according to Duncan’s multiple range test (6). All thestatistical analyses were performed using SuperAnova software (Abacus Con-cepts, Inc., CA). Nucleotide sequence accession numbers.  The 16S-23S rRNA gene ITS partialsequences of 25 newly isolated  Acacia -associated rhizobial strains were depositedin the GenBank database under accession numbers FJ025830 to FJ025853 andGQ443307. Strain Aust13c was previously sequenced under accession number AY603956 (1). RESULTSPhenotypic characterization of bacterial strains.  As indi-cated in Table 1, all of the strains isolated from  Acacia auricu- liformis  and  Acacia mangium , except Am2c, were slow-growingand formed flat and soft colonies and strikes (see Fig. S1 in thesupplemental material), like strain Aust13c, considered the  A. mangium  slow-growing reference strain here. Conversely, amajority of rhizobium strains isolated from the hybrid wereconsidered comparatively fast growing in pure culture andproduced convex and firm colonies and strikes (see Fig. S1 inthe supplemental material). Among the  Acacia  hybrid-associ-ated strains, only Ah1a, Ah4a, and AH8c were slow growingand had the same morphological type as Aust13c. Phylogenetic analysis of bacterial strains.  Based on 16S-23SrRNA gene ITS sequence comparisons that included referencebacterial species sequences, particularly, sequences of the  Bra- dyrhizobium  genospecies determined by Willems et al. (58, 59),all of the isolates studied, from both of the parental  Acacia species and their hybrid, were shown to belong to the  Brady- rhizobium  genus, and no isolates of other genera were found.The phylogenetic tree showed two major clades (Fig. 1). Thefirst clade included  B. elkanii  and  Bradyrhizobium  referencegenospecies VII, IX, X, and XI. A majority of isolates (13 outof 15) from the parental species  A. mangium  and  A. auriculi- formis  grouped diversely on this branch, which also containedonly three isolates from the hybrid, i.e., Ah1a, Ah4a, and AH8c. A majority (8 out of 11) of isolates from the hybrid wereclosely related to  B. yuanmingense  in the second well-differen-tiated clade, which included  B. japonicum , while only strain Am2c srcinating from  A. mangium  also grouped here. Symbiotic specificity between rhizobial strains and hostplants.  The in vitro experiment did not show any host speci-ficity of the  Bradyrhizobium  strains tested in terms of infectiv-ity, since they all formed nodules indifferently in  A. mangium ,  A. auriculiformis , and their hybrid, regardless of the geograph-ical or host plant srcin of the strains (Table 2). However, asevidenced by the analysis of variance, significant differences (at  P   0.05) were observed in the number of nodules formed bythe bacterial strains in  A. mangium  and the hybrid. On theother hand, no significant difference was observed in the num-ber of nodules formed by the same strains in  A. auriculiformis .The nodule dry weight varied according to the  Bradyrhizobium strain in  A. mangium  and  A. auriculiformis  but not in the 7754 LE ROUX ET AL. A  PPL  . E NVIRON . M ICROBIOL  .  hybrid. The dry weight of shoots varied significantly accordingto the strain in the two  Acacia  species and their hybrid (Table2). In both  A. mangium  and  A. auriculiformis , the host plantsrcin of a given strain had no effect on its degree of effectivity.For instance, strain Am1d, although isolated from  A. mangium ,formed inefficient nodules on this species. Concerning the hy-brid, four out of five tested strains from the  Acacia  hybrid werethe most efficient ones, even though the effectivity of somestrains srcinating from  A. mangium  and  A. auriculiformis  wasnot statistically different according to the Duncan multiplerange test (at  P   0.5). Three  Acacia  hybrid-associated strains were also ranked among the four most effective strains in  A. auriculiformis .The results of the greenhouse experiments reported in Table FIG. 1. Phylogenetic maximum parsimony tree based on 16S-23S rRNA gene ITS sequence of   Bradyrhizobium  spp. strains isolated from  Acacia mangium ,  A. auriculiformis , and the  A. mangium    A. auriculiformis  hybrid (in bold). Only bootstrap probability values higher than 70% (1,000replications) are given at the branching points. The type strains are indicated with the letter “T.” The reference sequences from GenBank are  Agrobacterium vitis T (U45329),  Burkholderia cepacia  (DQ273266),  Blastobacter denitrificans T (AF338176),  Bradyrhizobium japonicum T (AJ279264),  B. canariense  (AY386706),  B. elkanii T (AJ279308),  B. liaoningense T (AJ279301),  B. betae T (AJ631967),  B. yuanmingense  (AJ534605),  Bradyrhizo- bium  genospecies IV (AJ279281),  Bradyrhizobium  genospecies V (AJ279287),  Bradyrhizobium  genospecies VI (AJ279312),  Bradyrhizobium genospecies VII (AJ279272),  Bradyrhizobium  genospecies IX (AJ534597),  Bradyrhizobium  genospecies X (AJ534592),  Bradyrhizobium  genospeciesXI (AJ534594), and  Bradyrhizobium  genospecies IV (AJ279317). genosp., genospecies.V OL  . 75, 2009 SPECIFICITY OF BRADYRHIZOBIA FROM  ACACIA  HYBRID 7755  3 show that the homologous strain-  Acacia  associations, i.e.,  A. mangium  inoculated with Aust13c and the hybrid inoculated with AH12c, produced at least twice as many nodules as theheterologous associations 4 months after inoculation. In con-trast, no significant difference (at  P     0.05) between strains was found for nodule dry weight in  A. mangium , whereas thenodule biomass was higher with AH12c (72%) than with Aust13c in the  Acacia  hybrid. In  A. auriculiformis , AH12c pro-duced a higher nodule biomass (57%) and about three timesmore nodules than Aust13c. As for infectivity, strain effectivity was also higher in homologous strain-  Acacia  host associations, with shoot biomass increments of 79% and 78% in  A. mangium inoculated with Aust13c and the  Acacia  hybrid inoculated with AH12c, respectively. No significant difference between strains was found for shoot dry weight in  A. auriculiformis . DISCUSSIONMolecular characterization of bacterial strains.  Based onthe 16S-23S rRNA gene ITS, which shows more variability inlength and in sequence (21) than the widely used 16S rRNA gene, the 25 new bacterial nodule isolates from the three  Aca- cia  hosts were shown to belong to  Bradyrhizobium . The  Brady- rhizobium  isolates studied exhibited intrageneric diversity andranged in either of the two widely recognized major clades of   Bradyrhizobium , the  B. japonicum  and  B. elkanii  clades. Themajority of the isolates from the hybrid and only one  A. man- gium  isolate, Am2c, grouped on the  B. japonicum  branch closeto  B. yuanmingense . On the other hand, nearly all (except strain Am2c) rhizobial isolates from the parental tree species  A. mangium  and  A. auriculiformis  grouped on the  B. elkanii branch; only three isolates (Ah1a, Ah4a, and AH8c) from thehybrid grouped on this branch. However, the plant srcins of the two strains Ah1a and Ah4a remain questionable, since thehybrid status of their respective host plants of isolation has notbeen confirmed (uncertain phenotypic identification at har- vesting in the plantation) and might rather be  A. mangium .In contrast, the host plants from which the strains of the  B. japonicum  clade were isolated were genetically or phenotypi-cally confirmed as hybrids (20). The strains studied could notbe assigned to any particular  Bradyrhizobium  species. Theirprecise taxonomic position should be further clarified by DNA-DNA hybridization analysis or multilocus sequence analysis(56).The few other studies reporting the characterization of rhi- TABLE 2. Infectivity and effectivity of rhizobium strains on  A. mangium ,  A. auriculiformis , and  Acacia mangium   A. auriculiformis  hybridgrown under in vitro conditions Strain name Host plantof srcinMean result for  a :No. of nodules per plant Nodule dry wt (mg    plant  1 ) Shoot dry wt (mg    plant  1 )  A m A a A  hyb  A m A a A  hyb  A m A a A  hyb  Aust13c  A. mangium  20.8 bc 19.1 a 20.8 bc 5.20 d 4.72 d 4.86 a 69.3 ab 79.8 c 68.4 abc AG31d 23.4 ab 26.2 a 21.1 bc 7.05 abcd 8.95 a 4.81 a 69.4 ab 89.1 abc 57.4 abc Am1d 1.9 e 31.5 a 30.8 b 0.18 e 6.55 bcd 5.06 a 3.8 d 91.1 abc 50.0 cTAL 1449  A. auriculiformis  12.9 cd 28.2 a 19.6 bc 5.80 bcd 8.18 ab 5.35 a 56.8 bc 97.0 ab 69.3 abcScia2 32.0 a 24.0 a 51.5 a 7.58 abc 6.27 bcd 6.81 a 74.9 a 78.4 c 68.2 abcCGA1 8.7 de 23.1 a 15.5 c 6.57 abcd 7.44 abc 4.64 a 74.2 a 83.0 bc 70.7 abc AH12c  Acacia  hybrid 24.2 ab 24.4 a 26.5 bc 8.00 ab 8.74 a 5.77 a 51.6 c 93.3 abc 54.9 bc AH10 29.6 ab 23.2 a 32.1 b 8.61 a 9.04 a 6.95 a 56.0 bc 102.5 a 75.4 ab Ah1a 19.2 bc 20.4 a 25.1 bc 5.41 bcd 5.89 cd 4.55 a 65.5 abc 103.7 a 71.3 abc Ah4a NT NT 25.8 bc NT NT 4.96 a NT NT 71.7 abc AH11a NT NT 27.4 bc NT NT 5.26 a NT NT 79.2 aUninoculated control  b 0 0 0 — — — 4.0 d 13.3 d 25.2 d  a Values are means of the results obtained from eight replicates per strain tested 4 months after plant inoculation and growth under in vitro conditions. Meansfollowed by different letters in the same column are significantly different according to the Duncan multiple range test at a  P   value of 0.05.  A m ,  A. mangium ;  A a ,  A. auriculiformis ;  A  hyb,  Acacia mangium   A. auriculiformis  hybrid; NT, not tested, —, not applicable.  b Uninoculated control plants consisted of eight replicates per  Acacia  host treated with 1 ml of an autoclaved rhizobium culture of the Aust13c strain. TABLE 3. Infectivity and effectivity of Aust13c and AH12c strains on  A. mangium ,  A. auriculiformis , and  Acacia mangium   A. auriculiformis hybrid grown under greenhouse conditions Strain no. Host plant of srcinMean result for  a :No. of nodules per plant Nodule dry wt (mg    plant  1 ) Shoot dry wt (g    plant  1 )  A m A a A  hyb  A m A a A  hyb  A m A a A  hyb  Aust13c  A. mangium  219 a 98 b 231 b 162 a 90 b 220 a 2.65 a 1.97 a 1.72 b AH12c  Acacia  hybrid 111 a 285 a 596 a 171 a 141 a 128 a 1.48 b 1.79 a 3.06 aUninoculated control  b 0 0 0 — — — 0.11 c 0.09 b 0.09 c  a Values are means of the results 4.5 months after plant inoculation and growth under greenhouse conditions; in  A. mangium  and  A. auriculiformis , the means werecalculated from the results for 5 replicates per strain tested for both nodule number and nodule dry weight and from 10 replicates for shoot dry weight. In the  A. mangium   A. auriculiformis  hybrid, all parameters were measured from eight plants per inoculation treatment. Means followed by different letters in the same columnare significantly different according to the Duncan multiple range test at a  P   value of 0.05.  A m ,  A. mangium ;  A a ,  A. auriculiformis ;  A  hyb,  Acacia mangium    A. auriculiformis  hybrid; —, not applicable.  b Uninoculated control plants consisted of eight replicates per  Acacia  host treated with 1 ml of an autoclaved rhizobium culture of the Aust13c strain. 7756 LE ROUX ET AL. A  PPL  . E NVIRON . M ICROBIOL  .
Related Search
Advertisements
Similar documents
View more...
Advertisements
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks