Cloning, Characterization, and Sequencing of an Accessory Gene Regulator (agr) in Staphylococcus aureus

of 8

Please download to get full document.

View again

All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
PDF
8 pages
0 downs
2 views
Share
Description
JOURNAL OF BACTERIOLOGY, Sept. 1988, p /88/ $02.00/0 Copyright 1988, American Society for Microbiology Vol. 170, No. 9 Cloning, Characterization, and Sequencing of an Accessory
Transcript
JOURNAL OF BACTERIOLOGY, Sept. 1988, p /88/ $02.00/0 Copyright 1988, American Society for Microbiology Vol. 170, No. 9 Cloning, Characterization, and Sequencing of an Accessory Gene Regulator (agr) in Staphylococcus aureus H.-L. PENG,1 R. P. NOVICK,'* B. KREISWIRTH,l J. KORNBLUM,1 AND P. SCHLIEVERT2 The Public Health Research Institute, 455 First Avenue, New York, New York 10016,1 and Department of Microbiology, University of Minnesota, Minneapolis, Minnesota Received 4 May 1988/Accepted 12 May 1988 We have previously identified a gene in Staphylococcus aureus, agr, whose activity is required for high-level post-exponential-phase expression of a series of secreted proteins. In this paper, we describe the cloning of this gene in Escherichia coli by using an inserted transposon (TnSSI) as a cloning probe. The cloned gene, consisting of a 241-codon open reading frame containing the site of the transposon insertion, was recloned to an S. aureus vector, psk265, and shown to be functional in S. aureus. Activity was evaluated by determinations of a-hemolysin, IB-hemolysin, and toxic shock syndrome toxin-1 production in early-stationary-phase cultures. The cloned gene showed considerable variation with respect to different exoproteins and different host strains compared with the chromosomal agr determinant; this variation could not be attributed to the higher copy number of the cloned gene and probably reflects inapparent subtleties of the regulatory system. In Staphylococcus aureus, as in most other bacteria, there is a class of accessory proteins, many of which are secreted, that are produced in laboratory cultures at the end of exponential growth and during the stationary phase (5, 6). At the same time, the production of many proteins essential for growth and cell division is shut off. The regulation system that governs this changeover can be regarded as a metabolic toggle switch that is set at the end of exponential phase for accessory protein synthesis. When a new growth cycle is initiated (e.g., by dilution into fresh medium), the switch is reset for the synthesis of exponential-phase proteins. Neither the nature of the switch nor the identity of the metabolic factors involved is known. Pleiotropic mutations affecting the production of accessory proteins in S. aureus have been described by several groups (1, 10, 34), and it is likely that their analysis may be informative about this regulation system. Commonly, these mutations block post-exponentialphase synthesis of the following proteins: serine protease, nuclease, lipase, fibrinolysin, a-hemolysin,,-hemolysin, 8-hemolysin, enterotoxin B, and toxic shock syndrome toxin-1 (TSST-1), whereas production of certain other exoproteins, including protein A and coagulase, is increased (1, 25). One such mutation is a transposon TnS51 insertion isolated by Mallonee et al. (12) and referred to as hla on the basis of its a-hemolysin-negative phenotype. Studies of the mutant strain revealed that its a-hemolysin structural gene is intact (22) and that its pleiotropic regulatory phenotype is correlated with a lack of mrna corresponding to the genes whose expression is blocked (25; B. Kreiswirth and R. P. Novick, unpublished data). Consequently, with the concurrence of Pattee (P. A. Pattee, personal communication), we redesignated the gene agr (accessory gene regulator) (25). We report here the cloning, initial characterization, and sequencing of the agr gene and show that the cloned gene restores the secretory protein phenotype of agr mutants and also of spontaneous exoprotein-deficient (Exp-) mutants. * Corresponding author. MATERIALS AND METHODS Bacterial strains and plasmids. Table 1 contains the pedigrees of the staphylococcal strains used; Table 2 lists the plasmids. We have listed the pedigrees because we noticed retrospectively that certain of the 8325 derivatives in our stock collection that were used in these experiments are deficient in exoprotein production (Exp-), whereas others are proficient (Exp+). The genetic basis of the apparent lability of this trait is unknown. Note that RN450, derived from RN25 by UV-induced curing of 413, expresses,bhemolysin, in keeping with the observations of others that 413 lysogeny inactivates the,3-hemolysin gene (T. Foster, personal communication). The 3-hemolysin activity of RN450 is as low as it is in agr mutants such as ISP546. psk265 (kindly provided by S. Khan) is a derivative of pc194 (7) with the polylinker region of puc18 inserted at its unique HindIlI site. RN4220 is a nitrosoguanidine-induced mutant of RN450 that is efficiently transformed with DNA from Escherichia coli (11). Media and growth conditions. CY broth (17) was used for liquid cultures, shaken at 37 C, and monitored turbidimetrically with a Klett-Summerson photoelectric colorimeter read at 540 nm. GL agar (17) was supplemented with antibiotics as indicated. Tetracycline (Tc), chloramphenicol (Cm), and erythromycin (Em) were used at 5 pug/ml. Protoplast transformation was performed by the method of Chang and Cohen (2) as modified for S. aureus (20). Transduction was with phage 80a as described (16). Plasmid copy numbers were determined by fluorimetric densitometry of ethidium bromide-stained agarose gels (23). Plasmid stability was assessed by scoring the cultures used for exoprotein measurements for retention of the plasmid Cmr marker. Analysis of exoproteins. P-Lactamase was assayed colorimetrically with nitrocefin as the substrate (21); oa-hemolysin was assayed by serial dilution of supernatants taken from early-stationary-phase cultures with 0.5% whole defibrinated rabbit blood as the substrate. Samples were incubated for 90 min at 37 C and then held at 4 C for 30 min. Activity was determined by reading the samples turbidimetrically (Klett- Summerson colorimeter, red filter) and interpolating to cal- 4365 4366 PENG ET AL. J. BACTERIOL. TABLE 1. Strains used Exoprotein Production expression a-hemolysin.lstp P-Hemolysin TSST-1 NTCC , 442, 413 RN RN450 Low Low - RN4220b Low Low - RN ISP ISP546b - _ Low - RN6390b RN4282b Unknown RN4256b - - Unknown a The pedigree, beginning with NTCC 8325, is as foilows: from 8325 after UV treatment, RN25; from RN25 after UV treatment, RN450; from RN450 after nitrosoguanidine mutagenesis, RN4220; from RN450 after transduction with prn3032 (Tn551 donor), RN1478; from RN1478 after transduction with Cdr revertant of prn3032, ISP479; from ISP479 cured of prn3032, RN6390; from ISP479 after TnS51 insertion, ISP546. Also, from RN4282 transformed with Tn551 from ISP546, RN4256. culate the 50% lysis point. Activities (hemolytic units [HU]) are expressed as the reciprocal of the dilution giving 50% lysis; P-hemolysin was assayed in the same manner but with sheep instead of rabbit blood. Since a- and P-hemolysins are not absolutely specific for rabbit and sheep erythrocytes, respectively, strains Wood 46 (which produces only a- hemolysin) and TC82 (which produces only,) were used to determine the relative activities of the two hemolysins on each of the two blood cell types, and these relative activities (10% for 3-hemolysin on rabbit blood versus sheep blood and 3% for a-hemolysin on sheep versus rabbit blood) were used to correct the titers of strains that produced both. Although P-hemolysin inhibits the activity of a-hemolysin on sheep blood agar plates, no such inhibition was observed in the Tris-saline buffer used for the a-hemolysin titrations. TSST-1 was assayed immunologically as described by Schlievert et al. (29). Restriction mapping and cloning. Restriction endonucleases were purchased from Boehringer Mannheim Biochemicals and used as described by the manufacturer. Restriction mapping and fragment isolations were performed with ethidium bromide-cs-cl-purified plasmid DNA samples (4, 19). For molecular cloning, specific fragments were eluted from polyacrylamide gels, phenol extracted, and ethanol precipitated. For ligation, samples were combined in approximately equimolar ratios and incubated for 16 to 24 h at 14 C at a DNA concentration of at least 10,ug/ml and a ligase concentration of 40 U/ml. Cloning with pbr322, puc18, and m13 in E. coli was performed as described by Maniatis et al. (13). E. coli clones were verified by restriction analysis and by blot hybridization (30) as required. DNA sequencing was done by the dideoxynucleotide methods of Sanger and co-workers (27, 28) with ml3mplo and ml3mpll clones and a universal m13 sequencing primer purchased from Pharmacia. Blot hybridization. Southern blot hybridization was performed by standard methods (30) with nick-translated (26) samples of gel-purified DNA as probes. Northern blot hybridization was performed by the procedure of Thomas (32) with whole-cell RNA purified by extraction with guanidinium isothiocyanate followed by centrifugation through a CsCl step gradient. Nick-translated samples of gel-purified DNA fragments were used as probes. RESULTS Cloning of agr. Strain RN4256 (11) was constructed in connection with an earlier study of TSST (11) by transforming a naturally occurring toxic shock strain, RN4282, for erythromycin resistance (Emr) with DNA from ISP546, the original Tn551-induced agr mutant isolated by Mallonee et al. (12). A BglII fragment of plasmid prn3174 containing one end of Tn551 (19) was used to probe a BglII digest of chromosomal DNA of RN4256 (25) for TnSS1 sequences. A single 4.7-kilobase (kb) fragment hybridized to the probe. DNA from the region of the gel containing this fragment was eluted and cloned to pbr322 in E. coli, and positive clones were identified by hybridization with the same probe. One such clone contained about 4 kb of chromosomal sequences flanking the inserted transposon. A ClaI fragment derived from this clone, containing the end of the transposon plus about 2.8 kb of the flanking DNA, was then used to probe a lambda library prepared from a partial SauIllIa digest of RN4282 chromosomal DNA. Positive plaques were purified by subculture and used to prepare lambda DNA for restriction analysis and for subcloning in puc18. Restriction analysis of three clones (not shown) suggested that overlapping regions with different ends had been cloned. Initial subcloning of one of the X derivatives yielded a 4.0-kb EcoRI-PstI fragment that was used for further study. This fragment (Fig. 1) was found to contain sequences homologous to the ClaI probe plus about 2.3 kb of DNA distal to the original TnS5J insertion site. To test the cloned fragment for agr activity, we ligated it to an appropriately digested sample TABLE 2. Plasmids used Source or Plasmid Description reference psk265 pc194::puc19 PL' 9 pwn2018 pc194::ori ColE1::bla::pUCi8 PL 33 pwn2019 pc194::ori ColE1::bla::pUC19 PL 33 prn3032 p1258 blaz401 cad-52 seq prn3174 pi258a94 (mer--asi) 19 prn6583 psk265::agr-a2 This work prn6584 psk265: :agr-a4 This work prn6585 psk265::agr-a6 This work prn6632 psk265::agr-a10 This work prn6661 psk265::agr-a12 This work prn6662 psk265: :agr-a14 This work prn6663 psk265::agr-a16 This work prn6664 psk265::agr-a17 This work prn6599 pwn2019::agr-a8 This work prn6598 pwn2018::agr-a8 This work a PL, Polylinker. VOL. 170, 1988 ACCESSORY GENE REGULATOR 4367 TABLE 3. Expression of agr-regulated exoproteins Activity in host strain: fragmentr RN6390 (agr+) ISP546 (agr) RN4220 (agr) RN4282 (agr+) RN4256 (agr) a 13 a 13 a 13 a 13 TSST-1 TSST-1 None 1, 0.02 A ,600 3, A4 0.2 A6 0.2 A10 0.02 A ,200 2, A , A ,000 2, a a and,b, a-hemolysin and 1-hemolysin, respectively. Hemolysin activities are expressed as hemolytic units per milligram (dry weight) of cells; TSST-1 activity is expressed as micrograms of protein per milliliter. b psk265 derivative containing the indicated fragment (see Fig. 1). of psk265 DNA and used the ligation mnixture to transform S. aureus RN4220, with selection for chloramphenicol resistance. Plasmid DNA from one such transformant was used to transform two pairs of isogenic agr+lagr mutant strains, RN4282/RN4256 and RN6390/ISP546. As shown in Table 3, transformants of RN4256 (e.g., RN6122) produced TSST-1 and transformants of ISP546 (e.g., RN6114) produced oxhemolysin. However, the TSST-1 and ox-hemolysin activities (a) (b) IC-Q,, INSETION E Ev A Hc D PA Bo X T FC RHa A Pe A C E I I 1II* 1111 agr agr bp ORF:-3 IOR'F- 1 *4 I ORF-2 4 (c) (d) (6) E L- Hc L-. Hc (A2) (A4) Hc Ha (f) a(a6) -A (Al) Ps Ps B +.J agr 4500 bp agr bp agr 2371 bp agr 1271 bp (g) (h) (i) G) p (A8) R Ha (A1 4) R a (O) (A Iz (A12)2s Ha agr 782 bp agr bp agr 1102 bp agr 517 bp (k) Hc (A16) F. agr 989 bp (I) HHc (A17) T + agr 824~ bp FIG. 1. Cloning and mapping the agr gene. Line a represents chromosomal DNA with Tn5SI inserted in the agr region. Line b is a restriction map of the lambda clone containing agr. Abbreviations: A, AccII; B, BgIlI; Bs, BstEII; C, ClaI; D, DdeI; E, EcoRI; Ev, EcoRV; F, FnuDII; Ha, HaeIII; Hc, HincII; P, PvuII; Ps, PstI; R, RsaI; T, TthIII-I; X, XmnI. The extent of the sequenced region is indicated by a dashed line, and the three major ORFs identified are located and oriented as shown by the boxes below. Lines c to represent various restriction fragments that were subcloned into psk265 and scored for agr activity in RN4220. 4368 PENG ET AL. mw i. l FIG. 2. Blot hybridization analysis of agr clone. RN4282 chromosomal DNA and DNA prepared from the agr-positive A clone diagrammed in Fig. 1 were digested with restriction enzymes, separated by agarose gel electrophoresis, stained with ethidium bromide, and UV-photographed (left panel). The gel was then blotted to nitrocellulose and hybridized with a nick-translated sample of the A6 fragment (see Fig. 1). Tracks: 1 and 3, chromosomal DNA digests, 2 and 4, A DNA digests. Samples were digested with BgIII and EcoRI (tracks 1 and 2) or with BgII and Hincll (tracks 3 and 4). mw, Molecular weight markers (in thousands). of these transformants were not as high as those of the isogenic agr+ strains RN4282 and RN6390, respectively. Whereas TSST-1 production by RN4282 was unaffected by the A2 clone, a-hemolysin production by RN6390 was reduced by about 70%. A number of possibilities were considered that might account for the variability of the response to the cloned agr determinant. These possibilities are addressed below. Southern blot hybridization analysis. To test for the possibility that a rearrangement had occurred during cloning or that the X clones included noncontiguous DNA fragments, we compared chromosomal and clone restriction patterns by blot hybridization with the agr-specific probe A6 (Fig. 1). As shown in Fig. 2, the largest agr+ fragment, Al, was present in both chromosomal and X clone digests (lanes 3 and 4), suggesting that contiguous DNA has been cloned and that there was no gross rearrangement during cloning. The difference in size between the BglII-EcoRI fragments shown in lanes 1 and 2 is due to the presence of an EcoRI site at the X insert junction. We therefore consider it unlikely that DNA rearrangements could account for the difference in agr activity between the native and cloned genes. Subcloning. The agr determinant was mapped by subcloning. Various subfragments derived from the A2 fragment were inserted into the polylinker site of psk265 and used to transform S. aureus RN4220. Additionally, to test for the possibility that the A2 clone did not contain the entire agr n,r - 4-.Ir- m.3 J. BACTERIOL. determinant, we cloned from the agr-containing lambda fragment a segment containing about 2.2 kb to the right of A2 but lacking about 1.6 kb to the left, as shown in Fig. 1 (clone Al). Although this fragment was successfully cloned to puc18, we were unable to clone it in S. aureus, using the high-copy vector psk265. For each subclone, the plasmid insert was verified by restriction analysis, and the derivative clone was transferred to various agr+ and agr host strains. The resulting derivative strains were scored for production of a- and 1-hemolysins and TSST-1. The results of this subcloning are shown schematically in Fig. 1, and the exoprotein values are listed in Table 3. A number of subclones failed to activate the production of a-hemolysin. One of these, A10, in conjunction with the smallest agr+ clone, A17, defined the shortest segment, about 0.8 kb in length and containing the site of the TnSSI insertion in RN4256, that had detectable agr activity. The positive clones were remarkable in that they produced different agr responses with respect to one another, with respect to the three different exoproteins analyzed, and with respect to the various agr mutant host strains. RN4282 expressed only a trace of either a-hemolysin or 13-hemolysin, and so the RN4282/RN4256 pair was not studied for the effects of agr clones on the expression of these products. TSST-1 was expressed well in RN4282 and was not detectable in the agr derivative RN4256. None of the agr+ subclones restored full TSST-1 production in RN4256; all showed lower activities that seemed to represent at least two distinct levels of expression. In ISP546, none of the clones restored full a-hemolysin activity, and as with TSST-1 in RN4256, there appeared to be several levels of activity correlated with the size of the agr-bearing fragment.,-hemolysin activity in the ISP546 derivatives was approximately the same for all of the agr+ clones tested and was only slightly, if at all, lower than that observed with the agr+ parental strain, RN6390. RN4220 is derived from RN450, a spontaneous exoprotein-deficient mutant similar to the Exp- mutants described previously by Bjorklind and Arvidson (1). In RN4220, all of the agr+ clones strongly stimulated the expression of the two hemolysins-a to nearly the level shown by RN6390, and, to considerably higher levels-suggesting that the Exp- phenotype of RN4220 is due to a defect in agr expression. The agr defect in RN4220, however, is clearly different from that in ISP546. Thus, on the one hand, there was considerable residual expression of both hemolysins in RN4220 and both were stimulated about 10-fold by the cloned agr determinant in this strain. On the other hand, a-hemolysin was not detectably expressed in ISP546 and was stimulated at least 30-fold by agr, whereas,b-hemolysin showed considerable activity in this agr strain but was stimulated only about 3-fold by the agr clones. Genotypic variability among ISP546, RN6390, and RN4220 is unlikely to be a major factor, as the three are coancestral; however, RN4220 has been through a nitrosoguanidine mutagenesis, which could have had significant genotypic consequences. It is also unlikely that variations in plasmid copy number or stability could be responsible, as the agr-bearing clones were stable in all three strains and had copy numbers that were indistinguishable from one another (although higher than that of the parental plasmid, pc194), about 90 copies per cell (data not shown). Sequence analysis. We have determined the sequence of a 1.8-kb AccI fragment containing the site of the TnSSJ insertion inactivating agr, as shown in Fig. 1. Subfragments derived from this segment were cloned to ml3mplo or ml3mpll and sequenced by the dideoxynucleotide method VOL. 170, 1988 ACCESSORY GENE REGULATOR ACAATGTCTTATTAGATACAATTATCGAAAATGGTTTCTTTTATTCAAAAAGTTGAAATT -30 ATTAACAACTAGCCATAAGGATGTGAATGTATGAAAATTTTCATTTGCGAAGACGATCCA SD MetLysIlePheIleCysGluAspAspPro 31 AAACAAAGAGAAAACATGGTTACCATTATTAAAAATTATATAATGATAGAAGAAAAGCCT LysGlnArgGluAsnMetValThrIleIleLysAsnTyrIleMetIleGluGluLysPro 91 ATGGAAATTGCCCTCGCAACTGATAATCCTTATGAGGTGCTTGAGCAAGCTAAAAATATG MetGluIleAlaLeuAlaThrAspAsnProTyrGluValLeuGluGlnAlaLysAsnMet 151 AATGACATAGGCTGTTACTTTTTAGATATTCAACTTTCAACTGATATTAATGGTATCAAA AsnAspIleGlyCysTyrPheLeuAspIleGlnLeuSerThrAspIleAsnGlyIleLys 211 TTAGGCAGTGAAATTCGTAAGCATGACCCAGTTGGTAACATTATTTTCGTTACGAGTCAC LeuGlySerGluIleArgLysHisAspProValGlyAsnIleIlePheValThrSerHis 271 AGTGAACTTACCTATTTAACATTTGTCTACAAAGTTGCAGCGATGGATTTTATTTTTAAA SerGluLeuThrTyrLeuThrPheValTyrLysValAlaAlaMet
Related Search
Advertisements
Similar documents
View more...
Advertisements
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks