COMMENT CAPN10 Alleles Are Associated with Polycystic Ovary Syndrome

of 6

Please download to get full document.

View again

All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
PDF
6 pages
0 downs
0 views
Share
Description
COMMENT CAPN10 Alleles Are Associated with Polycystic Ovary Syndrome
Tags
Transcript
  COMMENT CAPN10  Alleles Are Associated with PolycysticOvary Syndrome  ALEJANDRO GONZALEZ, EDUARDO ABRIL, ALFREDO ROCA, MARIA JOSE´ ARAGO´N,MARIA JOSE´FIGUEROA, PILAR VELARDE, JOSE´LUIS ROYO, LUIS MIGUEL REAL,  AND  AGUSTI´N RUIZ Centro Avanzado de Fertilidad, Unidad de Reproduccio´n y Gene´tica Humana, Instituto Medico Serman, Jerez de la Frontera (A.G., E.A., A.Ro., M.J.A., M.J.F., P.V.), Ca´diz, Spain; Unidad Materno- Infantil, Hospital Virgen de las Montan˜as(A.G.), Villamartin, Ca´diz, Spain; and Departamento de Geno´mica Estructural, Neocodex, Parque Cientı´fico y Tecnolo´gico Isla de la Cartuja (J.L.R., L.M.R., A.Ru.), Sevilla, Spain Polycystic ovary syndrome (PCOS) is characterized bychronic anovulation infertility, hyperandrogenemia, and fre-quently insulin resistance. This study investigated whetherpolymorphisms in the  CAPN10  gene are related with PCOSetiology. The allelic frequencies and genotypes of   CAPN10 polymorphisms UCSNP-44, 43, 19, and 63 were determined in55 well characterized women with polycystic ovaries and 93unrelated healthy controls using spectrofluorimetric analy-ses and real-time PCR. Our data indicate that  CAPN10 UCSNP-44 allele is associated with PCOS in the Spanish pop-ulation (  P  0.01). These results support a role of Calpain 10gene in PCOS susceptibility in humans. (  J Clin Endocrinol Metab  87: 3971–3976, 2002) I N 1935, STEIN AND LEVENTHAL demonstrated thatobesity, hirsutism, and amenorrhea are correlated withpolycystic ovaries, identifying a novel syndrome namedStein-Leventhal or polycystic ovary syndrome (PCOS, MIM184700). PCOS is a common endocrinopathy that is found inabout 5–10% of women of reproductive age (1). Specificallyin Spain, a prospective study reported an overall 6.5% prev-alence of PCOS (2). Previous studies suggest that geneticsfactors play a major role in the etiology of PCOS (3). How-ever, the mode of inheritance of PCOS remains unclear, andrecentstudiesindicatethatthisdisorderisacomplextrait(4).This means that several genes are interacting with environ-mental factors to provoke the phenotype (5).Recentgeneticstudieshaveidentifiedseveralgeneswithindifferent metabolic pathways that could be involved in thepathogenesis of PCOS. Specifically, genes encoding for en-zymesofthesteroidhormonesynthesis( CYP11a , CYP17 ,and CYP19 ) have been tested using different linkage/associationmethods (6–8). In addition, genes involved in the insulin-signaling pathway (9–11), genes involved in gonadotropinaction (12, 13), genes controlling body weight,  APO E,  andtwo dopamine receptor genes have been analyzed (14–16).Most of these works have not been replicated extensively,and the molecular mechanism underlying the specific con-tributionofthesegenestoPCOSremainsunknown(8).How-ever, these works have pinpointed several metabolic routesthatmustcontainpolygenesinvolvedinPCOSsusceptibility.Depending on the series, PCOS is associated with a 2- to7-fold risk of type 2 diabetes mellitus (T2DM; Refs. 17, 18).Previous epidemiological and genetic studies have revealedthat PCOS and T2DM could share genetic susceptibility fac-tors involved in both pathologies. Following this workinghypothesis, several studies have demonstrated that loci in-volvedinT2DMmayplayaroleinPCOSpathogenesis(8–10,18, 19).A genomewide scan for T2DM genes in Mexican Ameri-cans localized  NIDDM1 , a susceptibility locus on chromo-some 2 (20). Interestingly, it has been shown that  NIDDM1 acts in concert with another locus located at chromosome 15within a genomic region that contains the  CYP19  gene (acandidate gene for PCOS) (21). Recently, the Calpain 10 gene( CAPN10 ),encodingaubiquitousmemberofthecalpain-likecysteine protease family, was positional cloned within NIDDM1  region (22). Association studies using intragenicmarkers of   CAPN10  gene have revealed that  CAPN10  allelesmay contribute to genetic predisposition to T2DM in differ-ent populations (22, 23) and also could modify proinsulinprocessing and insulin secretion in nondiabetic patients (24).Although the precise role of Calpain 10 in T2DM remainsunknown (25), UCSNP-43 polymorphism within intron 3 of  CAPN10  gene seems to be associated with reduced musclemRNA levels of   CAPN10  and insulin resistance (26).The aim of the present study was to investigate the role of  CAPN10 , a T2DM locus, in PCOS patients. We decided toexamine this hypothesis with an association study using apopulation-based series of patients with PCOS for the fre-quency of four intronic polymorphisms within  CAPN10 (USCSNP-43, UCSNP-44, UCSNP-19, and UCSNP-63). Ourresults indicate that  CAPN10  gene may play a role in PCOSsusceptibility in humans. Abbreviations: PCOS, Polycystic ovary syndrome; SNP, singlenucleotide polymorphism; T2DM, type 2 diabetes mellitus. 0013-7227/02/$15.00/0 The Journal of Clinical Endocrinology & Metabolism 87(8):3971–3976  Printed in U.S.A.  Copyright © 2002 by The Endocrine Society 3971  Patients and Methods  Patients The study population consisted of 55 unrelated women with PCOS.TheethnicityofallprobandsandwomencontrolswasCaucasian(whiteEuropid).PCOS was defined by the presence of 1) amenorrhea and/or oligomen-orrhea (menstrual cycles 35 d); 2) clinical hyperandrogenism: hirsutismfollowing Ferriman and Galleway criteria, acne, alopecia; 3) biochemicalhyperandrogenism:increasedtestosteronelevels(3nmol/liter);4)bilateralpolycysticovariesonultrasoundscan:morethaneightfolliclesofmorethan2-mmdiameter,increasedvolumeofstroma,andincreasedovarianvolume(9 ml; Ref. 27); and 5) exclusion criteria: hyperprolactinemia, thyroid dis-orders, and nonclassic 21-hydroxylase deficiency (27). Selected probandswere examined by one of the study investigators (A.G.). To estimate pop-ulation frequencies of single nucleotide polymorphisms (SNPs) analyzed,93 unselected healthy women from the same geographical region weregenotyped in an anonymized fashion. The referral center for this study isthe Centro Avanzado de Fertilidad (Jerez, Andalucia, Spain). Informedconsent was obtained from all patients.  DNA extraction We obtained 5 ml of peripheral blood from all patients to isolategermline DNA from leukocytes. DNA extraction was performed ac-cording to standard procedures using Nucleospin Blood Kit (Macherey-Nagel, Du ¨ ren, Germany). To perform PCRs, we prepared aliquots of DNA at a concentration of 5 ng/   l. The rest of the stock was cryopre-served at  20 C. Genotyping using real-time PCR Primers and probes.  We designed and synthesized amplification primersand fluorescent detection probes for the PCRs of the Calpain 10 geneusing the Oligo software (www.hgmp.mrc.ac.uk) following the manu-facturer ’ s instructions. The DNA sequence used to carry out this studycorresponds to the genomic sequence of the  CAPN10  gene (GenBankaccessionno.AF158748).Theselectedprimerpairsanddetectionprobesare summarized in Table 1.Allelic frequency and genotype distribution of UCSNP-19, -43, -44,and -63 within  CAPN10  gene were determined in 93 unselected women(Table 2). Our data indicate that the allele frequencies of UCSNP-44, -43,-19, and -63 in Spain are very similar to those reported for other Euro-pean populations elsewhere (Refs. 22, 23; Table 2). Spectrofluorimetricmethods reported here are fast and reliable, allowing rapid genotypingthat makes epidemiological studies more suitable to perform. PCR conditions.  Real-time PCR was performed in the LightCycler system(Roche Diagnostics, Mannheim, Germany) using reaction conditions pre-viouslypublished(28 – 30).PCRwasperformedtoamplifythesegmentsof the  CAPN10  gene that flanks UCSNP-43/44 (intron 3), UCSNP-19 (intron6), or UCSNP-63 (intron 13). Briefly, a final volume of 10  l using 10 ng of genomic DNA, 1 m m each amplification primer, 4.4 m m MgCl 2  , 0.2 m m eachdetectionprobe(whennecessary),and1ı`lofLCFaststartDNAMasterSYBRgreenI(RocheAppliedScience;forUCSNP-19or1ı`l)orLCFaststartDNA Master hybridization probes (Roche Applied Science) for UCSNP-43/44 and -63. We used an initial denaturation step of 95 C for 7 min,followed by 40 cycles of 95 C for 0 sec, 66 C for 15 sec, and 72 C for 30 sec.  Melting curves.  The conditions to obtain optimal melting curves and spec-trofluorimetric genotypes were 95 C for 0 sec, 50 C for 0 sec, and 95 C for0sec(withatemperature-transferspeedof20C/secineachstep,exceptthelast step, in which the speed of temperature transfer was 0.2 C/sec). In thelast step, a continuous fluorometric register was performed (F3/F1), fixingthe gains of the system at 1, 15, and 250 on channels F1, F2, and F3,respectively, for UCSNP-43/44 and UCSNP-63. To detect UCSNP-19, thefluorometric register was performed at F1 channel, fixing the gains of thesystemat5,10,10inchannelsF1,F2,andF3,respectively.Genotyperesultsusing real time-PCR are shown in Fig. 1. To test the specificity of theseassays, selected amplicons of different melting patterns were sequencedusinganautomatedDNAsequencer(BeckmanCoulterCEQ2000XL,Beck-man Coulter, Inc., Fullerton, CA; data not shown). For UCSNP-19 (32-bpinsertion/deletionpolymorphism),conventional2%agaroseelectrophore-sis was carried out (data not shown).  Statistical analysis Allelic frequencies between PCOS and controls where compared us-ing standard    2 tests with Yate’s correction. To perform statistical anal-ysis of genotypes, individuals heterozygous and homozygous for the  p allele of each SNP where grouped (when necessary) to avoid valueslower than 5 in cells. All statistical calculations where performed usingStatcalc software (EpiInfo 5.1). Results We have investigated 55 unrelated cases of PCOS comparedwith control population for the frequency of polymorphic al-leles at four loci within  CAPN10  gene (UCSNP-44, UCSNP-43,UCSNP-19, and UCSNP-63). Of these loci, an elevated fre-quency of the respective polymorphic allele occurred at twopolymorphisms in PCOS compared with women controls (Ta- ble 3). The associations were observed in UCSNP-44 (intron 3)and UCSNP-19 (intron 6). Among a total 110 PCOS chromo-somes, 25 (22.7%) have the polymorphic variant C, and 85(77.3%)havethewild-typeTatUCSNP-44locus.Incontrast,inthe Spanish population analyzed, we found 21 (11.3%) C poly-morphic and 165 (88.7%) T wild-type alleles, respectively. Thedifference in allelic frequencies in this genetic marker betweenPCOS and controls was statistically significant (   2  6.04;  P  0.01, with Yate’s correction). Moreover, for UCSNP-19, we alsoobtained a positive correlation: 52 of 110 (47.2%) PCOS alleleshave the deleted allele of this polymorphic marker, comparedwith 64 of 186 (34.4%) control chromosomes (   2   3.99;  P   0.045, with Yate’s correction). Interestingly, both polymorphicalleles UCSNP-44 (C) and UCSNP-19 (deleted), associated toPCOS phenotype in the present study, appear to be in linkagedisequilibrium (23). Moreover, the C allele of UCSNP-44 has been associated very recently to T2DM in European popula-tions (23).Genotype distributions for each polymorphism were alsodetermined and compared between PCOS and healthy TABLE 1.  Primers and probes used for genotyping   CAPN10 markers a UCSNP-43/UCSNP-44Primers43F 5  tccatagcttccacgcctcc 3  43R 5  aatcgtccaaccgctgcctc 3  Probes43-Sensor b 5  gCgaagtaaggcGtttgaag-Fl 3  43-Anchor 5  CY5-tgaggctaagccttgacttggtgagga-Ph 3  UCSNP-19Primers19F 5  caggcccagtttggttctcttc 3  19R 5  ctcccacaagcccaccct 3  UCSNP-63Primers63F 5  ctgacacttcactcggtcagag 3  63R 5  cttaggaagcttcttgagcctg 3  Probes63-Sensor 5  tgacgggggtggagCgaggg-Fl 3  63-Anchor 5  CY5-tgggccgcgtctgtgcaggctcaagaag-Ph 3  a Primer and internal probes used to amplify and detect genotypesof UCSNP-43, -44, -19, and -63 of the  CAPN10  gene. Nucleotides in capitals  within sensor probes represent the position sensitive for thewild-type and mutant alleles. Fl, Fluorescein; CY5, specific fluoro-chrome; Ph, phosphate at 3  . 3972  J Clin Endocrinol Metab, August 2002, 87(8):3971 – 3976 Gonzalez  et al.  •  Comments  women(Table3).AllgenotypefrequenciesareinaccordancewithHardy-Weinbergequilibriumlaw( P 0.43).Again,whencomparing genotypes observed in PCOS patients  vs . thoseobtainedincontrolgenotypes,asignificantassociationisalsoachievedforUCSNP-44genotypes(   2  5.99; P  0.023,withYate ’ s correction; for details, see Table 4). Discussion ThegeneticbasisofPCOSiscurrentlynotwellunderstood(31). However, it seems that the rule for most PCOS patientswill be the coexistence of both environmental and geneticfactorsinteractinginacomplexfashiontoprovokethePCOS TABLE 2.  Allele frequencies of   CAPN10  markers in different populations Geneticmarker a  China a USA  a  Mexican Americans a  Finland a Germany a UK  b Spain c UCSNP-44 na na 0.06 na na 0.15 0.11UCSNP-43 0.06 0.19 0.27 0.323 0.29 0.25 0.24UCSNP-19 0.38 0.40 0.41 0.28 0.29 0.39 0.34UCSNP-63 0.31 0.06 0.23 0.03 0.04 0.07 0.08na, Nonavailable. a  According to Horikawa  et al.  (22). b  According to Evans  et al.  (23). c Present work.F IG . 1. Spectrofluorimetric analysis of   CAPN10  markers using real-time PCR. Analysis of the fluorescence measured during melting curvedetermination in the LightCycler (Roche Applied Science). Each allele has a specific melting point. A, Detection of UCSNP-43 and -44polymorphisms (melting points, UCSNP-43 allele, 54 C; UCSNP-44 allele, 64 C; wild-type allele, 59.5 C). B, Detection of UCSNP-19 poly-morphism (melting points, deleted allele, 85.7 C; inserted allele, 86.8 C). C, Detection of UCSNP-63 polymorphism (melting points, UCSNP-63allele, 62 C; wild-type, 69.5 C). Gonzalez  et al.  •  Comments J Clin Endocrinol Metab, August 2002, 87(8):3971 – 3976  3973  phenotype (4). This etiology model is applied for almost allcommon diseases such schizophrenia, dementia, cardiovas-cular diseases, or diabetes mellitus (5).Recent studies have identified several  CAPN10  alleles as-sociated to T2DM susceptibility (22 – 24). Initially, the inher-itance of a specific haplotype combination defined by threeSNPs (UCSNP-43, -19, and -63) was found to be associatedwith an increased risk of T2DM in Mexican Americans (22).However, the examination of the contribution of   CAPN10 alleles to the development of diabetes mellitus in Europeansrevealed that UCSNP-44, rather than UCSNP-43, is associ-atedtogeneticpredispositiontoT2DMinEuropids(23).Ourdata provide support for the involvement of   CAPN10 UCSNP-44 as a determinant of risk for PCOS in Spanishpopulation, suggesting that UCSNP-44 allele could be re-lated to both pathologies. Our study provides a new candi-date gene for PCOS that must be widely evaluated. Furtherstudies in PCOS cohorts of other ethnicity and geographicallocation will be necessary to check our results. In this way,itwouldbeinterestingtoperformmeta-analysesofourfind-ings testing autosomal dominant PCOS families, sib pairsanalyses, and new case-control studies; increasing PCOSsample; and testing family-based controls and/or popula-tion-basedcontrolstoevaluate,contrastandweightourfind-ings.Moreover,itisinterestingtoevaluatethe CAPN10 genein other lipodystrophies observed in humans like the met-abolic syndrome observed in hypertension, congenital li-podystrophies, or lipodystrophy related with antiretrovi-ral treatments.Our study also provides a novel genetic evidence of therelationships between T2DM and PCOS, suggesting that both pathologies share clinical findings, biochemical path-ways, and genetic risk factors (18, 32). It will be very inter-esting to perform association studies between some pheno-typic characteristics of PCOS patients ( i . e .   -cell functionparameters, insulin resistance, family history of diabetes,hypertensionorhyperinsulinemia)and CAPN10 haplotypes.However, due to small sample size available, we cannotperformthesestudiesinthePCOSgroup.Inthisway,wearecurrently collecting 4-fold PCOS samples within our geo-graphicalregiontoperformphenotype-genotypecorrelationstudies.Weandothersthinkthatthediscoveryofmolecularmech-anisms underlying the link between T2DM and PCOS couldprovide a core of important proteins and functions veryinterestingformoleculardiagnosisanddrugdevelopmentinPCOS (4, 31). In this way, physiological links between PCOSand insulin-signaling pathways have been reported at a mo-lecular level, suggesting that IGF pathways are involved inovarian steroidogenesis and follicle maturation (32, 33). It iswell established that ovarian theca cells are stimulated viainsulin-insulin receptor pathways and IGF-I to synthesizeandrogens and to perform apoptosis inhibition of growingfollicles. On the other hand, a high bioavailability of IGF-IIatovariangranulosecelllevelprovokeshighlevelsofCYP19aromatase, follicle growth, maturation, and an increased es-tradiol synthesis (34 – 37). Recent studies suggest that an ab-normalratioofIGF-I/IGF-IIatovarianlevelcouldcontributeto the development of ovarian cysts and hyperandrogen-emia.BothsymptomsareobservedinPCOSpatients(38,39).Because the IGF-I/IGF-II ratio is strongly regulated via IGF binding proteins and unidentified proteases controlling IGF TABLE 3.  Association studies of   CAPN10  alleles in PCOS Genetic marker a  Alleles PCOS patients(n  55, 110 chromosomes)Spanish population(n  93, 186 chromosomes) Statistical analysis b UCSNP-44    2  6.04,  P  0.01T 85 165C 25 21UCSNP-43    2  0.03,  P  0.86G 81 140 A 29 46UCSNP-19    2  3.99,  P  0.045Inserted 58 120Deleted 52 64UCSNP-63    2  0.73,  P  0.39C 95 167T 13 15 a  According to Horikawa  et al.  (22). b   2 with Yate ’ s correction. TABLE 4.  Genotype analysis of   CAPN10  polymorphisms in PCOSpatients and Spanish population Genotypesobservedin PCOS  P  valueGenotypesobservedin controlpopulation  P  value a UCSNP-44 0.87 a , 0.02 b 0.97TT 34 75TC 17 15CC 4 3UCSNP-43 1.0 a , 0.97 b 0.82GG 31 54GA 19 32 AA 5 7UCSNP-19 0.97 a , 0.1 b 0.43Del/Del 13 15Del/Ins 26 34Ins/Ins 16 43UCSNP-63 1.0 a , 0.71 b 1.0CC 43 76CT 9 15TT 2 0Del, Deleted; Ins, inserted. a   2 HWE: Hardy-Weinberg equilibrium, compares observed ge-notypes in a population versus those inferred with the Hardy-Wein-berg law algorithm (p 2  2pq  q 2  1). b   2 PCOS  vs.  controls. 3974  J Clin Endocrinol Metab, August 2002, 87(8):3971 – 3976 Gonzalez  et al.  •  Comments   bindingproteinactivities(40),itistemptingtospeculatehowCAPN10 protease could be related to the fine tuning of insulin-dependent biochemical pathways involved in ovar-ian physiology.Finally, Cox  et al . (21) have reported a genetic interaction between CAPN10 andseveralgeneticmarkerscloseto CYP19 aromatase locus in T2DM patients. Because  CYP19  aro-matase encodes a core protein involved in ovarian steroidsynthesis, it will be interesting to analyze this phenomena inPCOS patients and its relation to androgen/estrogen syn-thesis in the ovary.Furtherassociationandfunctionalstudiesarenecessarytoclarify the role of   CAPN10  alleles in diabetes, PCOS, andovarian physiology. In this way, expression analyses andother  in vitro  experiments in thecal and granulose cells of selected patients are under investigation. We believe thatthese new studies will help to elucidate the molecular mech-anism of the new genetic association discovered.  Acknowledgments WearedeeplygratefultoPCOSpatientsandcontrolsforparticipationinthisstudy.WeareverygratefultoSonsolesVidal,MaytePizarro,andDr. Ana Bernal for patient and sample management.Received January 3, 2002. Accepted May 10, 2002.Address all correspondence and requests for reprints to: Dr. Alejan-droGonzalez,CentroAvanzadodeFertilidad,UnidaddeReproduccio ´ ny Gene ´ tica Humana, Instituto Medico Serman, 11405 Jerez de la Fron-tera, Ca ´ diz, Spain. E-mail: alejandro@caf-jerez.com.Neocodex has been partially funded by the Ministerio de Ciencia yTecnolog ı´ a (Grants IDE2000-0633, IDE2000-0705 and FIT-010000-2001-86). References 1.  Asteria C  2000 Identification of follistatin as a possible trait-causing gene inpolycystic ovary syndrome. Eur J Endocrinol 143:467 – 4692.  AsuncionM,CalvoRM,SanMillanJL,SanchoJ,AvilaS,Escobar-MorrealeHF  2000 A prospective study of the prevalence of the polycystic ovary syn-drome in unselected Caucasian women from Spain. J Clin Endocrinol Metab85:2434 – 24383.  Legro RS, Driscoll D, Strauss III JF, Fox J, Dunaif A  1998 Evidence for agenetic basis for hyperandrogenemia in polycystic ovary syndrome. Proc NatlAcad Sci USA 95:14956 – 149604.  Crosignani PG, Nicolosi AE  2001 Polycystic ovarian disease: heritability andheterogeneity. Hum Reprod Update 7:3 – 75.  WeissKM,TerwilligerJD 2000Howmanydiseasesdoesittaketomapagenewith SNPs? Nat Genet 26:151 – 1576.  Carey AH, Waterworth D, Patel K, White D, Little J, Novelli P, Franks S,Williamson R  1994 Polycystic ovaries and premature male pattern baldnessareassociatedwithonealleleofthesteroidmetabolismgeneCYP17.HumMolGenet 3:1873 – 18767.  GharaniN,WaterworthDM,BattyS,WhiteD,Gilling-SmithC,ConwayGS,McCarthyM,FranksS,WilliamsonR 1997Associationofthesteroidsynthesisgene CYP11a with polycystic ovary syndrome and hyperandrogenism. HumMol Genet 6:397 – 4028.  Urbanek M, Legro RS, Driscoll DA, Azziz R, Ehrmann DA, Norman RJ,Strauss III JF, Spielman RS, Dunaif A  1999 Thirty-seven candidate genes forpolycystic ovary syndrome: strongest evidence for linkage is with follistatin.Proc Natl Acad Sci USA 96:8573 – 85789.  McKeigue P, Wild S  1997 Association of insulin gene VNTR polymorphismwith polycystic ovary syndrome. Lancet 349:1771 – 177210.  Waterworth DM, Bennett ST, Gharani N, McCarthy MI, Hague S, Batty S,Conway GS, White D, Todd JA, Franks S, Williamson R  1997 Linkage andassociation of insulin gene VNTR regulatory polymorphism with polycysticovary syndrome. Lancet 349:986 – 99011.  TalbotJA,BicknellEJ,RajkhowaM,KrookA,O’RahillyS,ClaytonRN 1996Molecular scanning of the insulin receptor gene in women with polycysticovarian syndrome. J Clin Endocrinol Metab 81:1979 – 198312.  ElterK,ErelCT,CineN,OzbekU,HacihanefiogluB,ErtungealpE 1999RoleofthemutationsTrp8 f ArgandIle15 f Throfthehumanluteinizinghormone  -subunit in women with polycystic ovary syndrome. Fertil Steril 71:425 – 43013.  Conway GS, Conway E, Walker C, Hoppner W, Gromoll J, Simoni M  1999Mutationscreeningandisoformprevalenceofthefolliclestimulatinghormonereceptor gene in women with premature ovarian failure, resistant ovary syn-drome and polycystic ovary syndrome. Clin Endocrinol 51:97 – 9914.  Kahsar-Miller M, Boots LR, Azziz R  1999 Dopamine D3 receptor polymor-phism is not associated with the polycystic ovary syndrome. Fertil Steril71:436 – 43815.  Legro RS, Dietz GW, Comings DE, Lobo RA, Kovacs BW  1994 Associationof dopamine D2 receptor gene haplotypes with anovulation and fecundity infemale Hispanics. Hum Reprod 9:1271 – 127516.  Heinonen S, Korhonen S, Hippelainen M, Hiltunen M, Mannermaa A,Saarikoski S  2001 Apolipoprotein E alleles in women with polycystic ovarysyndrome. Fertil Steril 75:878 – 88017.  Dunaif A  1995 Hyperandrogenic anovulation (PCOS): a unique disorder of insulin action associated with an increased risk of non-insulin-dependentdiabetes mellitus. Am J Med 98:33S – 39S18.  Colilla S, Cox NJ, Ehrmann DA  2001 Heritability of insulin secretion andinsulinactioninwomenwithpolycysticovarysyndromeandtheirfirstdegreerelatives. J Clin Endocrinol Metab 86:2027 – 203119.  Eaves IA, Bennett ST, Forster P, Ferber KM, Ehrmann D, Wilson AJ, Bhat-tacharyya S, Ziegler AG, Brinkmann B, Todd JA  1999 Transmission ratiodistortion at the INS-IGF2 VNTR. Nat Genet 22:324 – 32520.  Hanis CL, Boerwinkle E, Chakraborty R, Ellsworth DL, Concannon P,Stirling B, Morrison VA, Wapelhorst B, Spielman RS, Gogolin-Ewens KJ,Shepard JM, Williams SR, Risch N, Hinds D, Iwasaki N, Ogata M, OmoriY, Petzold C, Rietzch H, Schroder HE, Schulze J, Cox NJ, Menzel S, BorirajVV, Chen X, Lim LR, Lindner T, Mereu LE, Wang Y-Q, Xiang K, YamagataK, Yang Y, Bell GI  1996 A genome-wide search for human non-insulin-dependent (type 2) diabetes genes reveals a major susceptibility locus onchromosome 2. Nat Genet 13:161 – 16621.  CoxNJ,FriggeM,NicolaeDL,ConcannonP,HanisCL,BellGI,KongA 1999Loci on chromosomes 2 (NIDDM1) and 15 interact to increase susceptibility todiabetes in Mexican Americans. Nat Genet 21:213 – 21522.  Horikawa Y, Oda N, Cox NJ, Li X, Orho-Melander M, Hara M, Hinokio Y,LindnerTH,MashimaH,SchwarzPE,delBosque-PlataL,HorikawaY,OdaY, Yoshiuchi I, Colilla S, Polonsky KS, Wei S, Concannon P, Iwasaki N,Schulze J, Baier LJ, Bogardus C, Groop L, Boerwinkle E, Hanis CL, Bell GI 2000 Genetic variation in the gene encoding calpain-10 is associated with type2 diabetes mellitus. Nat Genet 26:163 – 17523.  Evans JC, Frayling TM, Cassell PG, Saker PJ, Hitman GA, Walker M, Levy JC, O’Rahilly S, Rao PV, Bennett AJ, Jones EC, Menzel S, Prestwich P,Simecek N, Wishart M, Dhillon R, Fletcher C, Millward A, Demaine A,Wilkin T, Horikawa Y, Cox NJ, Bell GI, Ellard S, McCarthy MI, HattersleyAT  2001 Studies of association between the gene for calpain-10 and type 2diabetes mellitus in the United Kingdom. Am J Hum Genet 69:544 – 55224.  StumvollM,FritscheA,MadausA,StefanN,WeisserM,MachicaoF,HaringH  2001 Functional significance of the UCSNP-43 polymorphism in theCAPN10 gene for proinsulin processing and insulin secretion in nondiabeticGermans. Diabetes 50:2161 – 216325.  PermuttMA,Bernal-MizrachiE,InoueH 2000 Calpain 10: the first positionalcloning of a gene for type 2 diabetes? J Clin Invest 106:819 – 82126.  Baier LJ, Permana PA, Yang X, Pratley RE, Hanson RL, Shen GQ, Mott D,Knowler WC, Cox NJ, Horikawa Y, Oda N, Bell GI, Bogardus C  2000 Acalpain-10 gene polymorphism is associated with reduced muscle mRNAlevels and insulin resistance. J Clin Invest 106:R69 – R7327.  Zawadzky JK, Dunaif A  1992 Diagnostic criteria for polycystic ovary syn-drome: towards a rational approach. In: Dunaif A, Givens JR, Haseltine F,Merrian GR, eds. Polycystic ovary syndrome. Boston: Blackwell; 377 – 38428.  Royo JL, Ruiz A, Borrego S, Rubio A, Sanchez B, Nunez-Roldan A, LissenE, Antinolo G  2001 Fluorescence resonance energy transfer analysis of CCR-V64IandSDF1-3  apolymorphisms:prevalenceinsouthernSpainHIVtype1  cohort and noninfected population. AIDS Res Hum Retroviruses 17:663 – 66629.  Real LM, Gayoso AJ, Olivera M, Caruz A, Ruiz A, Gayoso F  2001 Detectionofnucleotidec985A 3  Gmutationofmedium-chainacyl-CoAdehydrogenasegene by real-time PCR. Clin Chem 47:958 – 95930.  Ruiz A, Antinolo G, Marcos I, Borrego S  2001 Novel technique for scanningof codon 634 of the RET protooncogene with fluorescence resonance energytransferandreal-timePCRinpatientswithmedullarythyroidcarcinoma.ClinChem 47:1939 – 194431.  Franks S, White D, Gilling-Smith C, Carey A, Waterworth D, Williamson R 1996 Hypersecretion of androgens by polycystic ovaries: the role of geneticfactors in the regulation of cytochrome P450c17   . Baillieres Clin EndocrinolMetab 10:193 – 20332.  Herna´ndez ER, Hurwitz A, Vera A, Pellicer A, Adashi EY, LeRoith D, Rob-erts Jr CT  1992 Expression of the genes encoding the insulin-like growthfactors and their receptors in human ovary. J Clin Endocrinol Metab 74:419 – 42533.  Zhou J, Bondy C  1993 Anatomy of the human ovarian insulin-lilke growthfactor system. Biol Reprod 48:467 – 47034.  El-Roeiy A, Chen X, Roberts VJ, Shimasakai S, Ling N, LeRoith D, Roberts Jr CT, Yen SS  1994 Expression of the genes encoding the insulin-like growthfactors, the IGF and insulin receptors, and IGF-binding proteins-1 – 6 and the Gonzalez  et al.  •  Comments J Clin Endocrinol Metab, August 2002, 87(8):3971 – 3976  3975
Related Search
Advertisements
Similar documents
View more...
Advertisements
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks